
by nebularosa

  • Streaming + Download

    Includes unlimited streaming via the free Bandcamp app, plus high-quality download in MP3, FLAC and more.

    Bonus track by xname.

      £7 GBP  or more


  • Record/Vinyl + Digital Album

    A compilation that takes the lullaby genre into the realm of experimental electronic music, assembled from an open call for experimental lullabies launched in May 2014. Composed for Nintendo, Atari, Pure Data, Supercollider, D-Box, tape recorders, as well as ultraStethoscopes or using radioactive materials, these recordings treat the lullaby genre as an example of consciousness-altering music.

    Includes unlimited streaming of Nebulullaby via the free Bandcamp app, plus high-quality download in MP3, FLAC and more.
    ships out within 5 days
    edition of 500 

      £18 GBP or more 




released May 1, 2016



Some rights reserved. Please refer to individual track pages for license info.


nebularosa London, UK

Experimental electronic music

contact / help

Contact nebularosa

Streaming and
Download help

Redeem code

Track Name: Samuel Hertz - Blue Heron

Follow the below steps to run Blue Heron. Amino Acid Cycles have variable intervals built into their patterns, so each cycle should be given time to run before starting the next one.

Users will have to have the ProteinBioSynthesis external library installed to run pattern cycles:

1. Run SynthDef
2. Run Cycle 1
3. Run Cycle 2
4. " " 3
5. " " 4
6. Within the SynthDef, slowly change the impulse time number pairs within the .range(x, y) parameters. Suggested number pairs are listed next to it. Once you have changed the number pairs, run the code block again and the changes will take place.

//SYNTHDEF init.
SynthDef("amino", { arg out, freq=440, sustain=0.25, pan, p, amp=0.1;
var u;
u =, 0, sustain, doneAction:2) *
freq * p, 0,
*, 20) //impulse_time-- live coding: (2, 20) orig. (1, 5) --> (0.1, 1) --> (0.01, 0.1) --> (0.001, 0.01)
out,, pan, amp)

var pat;
pat = AminoacidPattern("gatggatgcgatcggcttaggggctagcgatcgggatcg", inf);
\instrument, \amino,
\degree, pat - 1,// 10
\stepsPerOctave, 5,
\dur, pat *10, //10
\p, pat / 2,
\legato, Prand([2, 1, 1, 7, 5, 1], inf) * 1.4,
\pan, pat / 10 - 1,
\amp, Pbrown(0.01, 0.05, 0.05, inf)

var pat;
pat = AminoacidPattern("tatgatggggctagcgattcattccag", inf);
\instrument, \amino,
\degree, pat - 1, // 10
\stepsPerOctave, 5,
\dur, pat *20, //20
\p, pat / 1,
\legato, Prand([9, 5, 10, 7, 15, 10], inf) * 1.4,
\pan, pat / 10 - 1,
\amp, Pbrown(0.01, 0.05, 0.09, inf)

var pat;
pat = AminoacidPattern("atgatgattgctagctattcagtccag", inf);
\instrument, \amino,
\degree, pat - 1,
\stepsPerOctave, 12,
\dur, pat *0.25,
\p, pat / 1,
\legato, Prand([9, 5, 10, 7, 15, 10], inf) * 1.4,
\pan, pat / 10 - 1,
\amp, Pbrown(0.01, 0.10, 0.05, inf)

var pat;
pat = AminoacidPattern("catactgatctccatagccatcaggtc", inf);
\instrument, \amino,
\degree, pat - 1,
\stepsPerOctave, 12,
\dur, pat *0.1,
\p, pat / 1,
\legato, Prand([1, 2, 1, 4, 1, 3], inf) * 1.4,
\pan, pat / 10 - 1,
\amp, Pbrown(0.01, 0.10, 0.05, inf)
Track Name: 0xA - lullaby_in.c
Track Name: Thor Magnusson - Radiguelising Babies
Track Name: Erich Barganier - Fading Out
{ | freq = 900 |
var wave =,0.10,0.30), 300);
var noise =;, wave ! 2);, noise ! 2);
{ | freq = 1800 |
var wave =,0.10,0.30), 300);
var noise =;, wave ! 2);, noise ! 2);
{arg freq = 440, dec = 1.0;
var sin =, 0, 0.25) *, dec), doneAction:
2);, sin ! 2);}).play;
~drone = Pbind(
\instrument, "\lowSynth",
\scale, [0,2,5],
\random, Pwhite(80, 100),
\amp, Pseq([0.000000000000000000000000000000000000000000000000000000005],
\midinote, Pfunc({|event|\random).nearestInScale(
\dur, Pfunc({|event|
var midinote, degree, scale;
midinote =\midinote);
scale =\scale);
degree = midinote.keyToDegree(scale, 12) %
scale.size + 1;
if (degree%2==0,
~ring = Pbind(
\instrument, "\Ring",
\scale, [0,2,4,5],
\random, Pwhite(80, 100),
\amp, Pseq([0.00000000000000000000000000005], inf),
\midinote, Pfunc({|event|\random).nearestInScale(
\dur, Pfunc({|event|
var midinote, degree, scale;
midinote =\midinote);
scale =\scale);
degree = midinote.keyToDegree(scale, 12) %
Page 1
scale.size + 1;
if (degree%2==0,
Page 2
Track Name: Repl Electric - The Stars
(def the-stars (dark-ambience))

(def nebula (growl [:head bass-g] :amp 0.0 :beat-trg-bus (:beat
time/beat-16th) :beat-bus (:count time/beat-16th) :note-buf
(def hydrogen (shrill-pong [:head voice-g] :amp 1.2 :note-buf
hydrogen-note-buf :duration-bus hydrogen-dur-buf))
(def helium (shrill-pong [:head voice-g] :amp 1.2 :note-buf
helium-note-buf :duration-bus helium-dur-buf))
(def supernova (shrill-pong [:head voice-g] :amp 0.1 :note-buf
supernova-note-buf :duration-bus supernova-dur-buf))
(def stellar-wind (pulsar :note-buf stella-wind-note-buf :amp 0.7))
(def metallicity (fizzy-pulsar [:head backing-voice-g] :amp 0.6
:note-buf metallicity-note-buf :duration-bus supernova-dur-buf))
Track Name: David Jason Snow - Yo Gaba Gaba
'by David Jason Snow
'Sept. 16, 2014
'Language: HiSoft BASIC for the Atari Falcon030 computer
defint a-z
library "gemaes","gemdos"
CONST steps_per_quarternote=96
gosub initialize
if int(rnd*100)>49 then
gosub set_tempo
end if
for index=0 to 7
if int(rnd*100)>64 then
end if
for pulse=1 to iterations
for index=0 to 7
velocity_index(index)=(velocity_index(index)+1) mod 64
gosub play_note
if FNabort then
exit loop
end if
mouse 0
gosub save_midi file
DEF FNabort
if inp(-2)<>-1 then
if inp(2)=27 then
end if
end if
SUB note_off(channel,pitch)
SHARED smf_buffer&,smf_index&
out 3,128+channel
out 3,pitch
out 3,64
gosub delta_conversion
pokeb smf_buffer&+smf_index&,128+channel
incr smf_index&
pokeb smf_buffer&+smf_index&,pitch
incr smf_index&
pokeb smf_buffer&+smf_index&,64
incr smf_index&
SUB note_on(channel,pitch,velocity)
SHARED smf_buffer&,smf_index&
out 3,144+channel
out 3,pitch
out 3,velocity
gosub delta_conversion
pokeb smf_buffer&+smf_index&,144+channel
incr smf_index&
pokeb smf_buffer&+smf_index&,pitch
incr smf_index&
pokeb smf_buffer&+smf_index&,velocity
incr smf_index&
for index=0 to 7
if active_voice(index) then
note_on channel(index),note(index),velocity(index)
end if
while delay!>timer: wend
for index=0 to 7
if active_voice(index) then
note_off channel(index),note(index)
end if
mouse -1
window fullw
restore mode_data
dim combination_mode(3)
for index&=0 to 3
read word$
pokew varptr(combination_mode(0))+index&*2,val(word$)
restore sysex_data
dim sysex(73)
for index=0 to 73
read word$
pokew varptr(sysex(0))+index*2,val(word$)
dim channel(7)
dim X!(7)
dim Y!(7)
dim new_X!(7)
dim new_Y!(7)
for index=0 to 7
dim pitch(3,36)
restore scale_1_data
for index=0 to 6
read pitch(0,index)
restore scale_2_data
for index=0 to 6
read pitch(1,index)
restore scale_3_data
for index=0 to 6
read pitch(2,index)
restore scale_4_data
for index=0 to 6
read pitch(3,index)
dim velocity_index(7)
for index=0 to 7
restore velocity_data
dim velocity_scale(63)
for index=0 to 63
read velocity_scale(index)
gosub sysex_dump
dgetpath getdir&,0
index=0: while peekb(getdir&+index)<>32: index=index+1: wend
midi file_path$=path$+"\*.MID"
dim smf_buffer(buffer_size&\2)
pokeb smf_buffer&,asc("M")
pokeb smf_buffer&+1,asc("T")
pokeb smf_buffer&+2,asc("h")
pokeb smf_buffer&+3,asc("d")
pokel smf_buffer&+4,6 'length of header
pokew smf_buffer&+8,0 'SMF format 0
pokew smf_buffer&+10,1 '1 track
pokew smf_buffer&+12,steps_per_quarternote
pokeb smf_buffer&+14,asc("M")
pokeb smf_buffer&+15,asc("T")
pokeb smf_buffer&+16,asc("r")
pokeb smf_buffer&+17,asc("k")
pokel smf_buffer&+18,0 'dummy track length
gosub set_tempo
pokeb smf_buffer&+smf_index&,&h00 'delta time
incr smf_index&
pokeb smf_buffer&+smf_index&,&hff 'meta event
incr smf_index&
pokeb smf_buffer&+smf_index&,&h51
incr smf_index&
pokeb smf_buffer&+smf_index&,&h03
incr smf_index&
pokeb smf_buffer&+smf_index&,peekb(smf_tempo_ptr&+1)
incr smf_index&
pokeb smf_buffer&+smf_index&,peekb(smf_tempo_ptr&+2)
incr smf_index&
pokeb smf_buffer&+smf_index&,peekb(smf_tempo_ptr&+3)
incr smf_index&
pokeb vlq_pointer&+3,delta_time& and &h7f
while delta_time&<>0
pokeb vlq_pointer&+pointer_offset&,delta_time& or &h80
decr pointer_offset&
incr pointer_offset&
while pointer_offset&<4
pokeb smf_buffer&+smf_index&,peekb(vlq_pointer&+pointer_offset&)
incr smf_index&
incr pointer_offset&
save_midi file:
mouse 0
gosub delta_conversion
pokeb smf_buffer&+smf_index&,&hff 'meta-event
incr smf_index&
pokeb smf_buffer&+smf_index&,&h2f
incr smf_index&
pokeb smf_buffer&+smf_index&,&h00
pokel smf_buffer&+18,smf_index&-22 'update sequence length
fsel_input midi file_path$, file_name$,ok
if ok then
if file_name$="" then
alert$="[3][Are you sure you want|to discard MIDI file?][Yes|No]"
if FNform_alert(1,alert$)=2 then
goto save_midi
end if
mouse 2
index=len(midi file_path$)
while index>0 and mid$(midi file_path$,index,1)<>"\"
decr index
exit_file$=left$(midi file_path$,index)+file_name$
mouse 0
end if
alert$="[3][Are you sure you want|to discard MIDI file?][Yes|No]"
if FNform_alert(1,alert$)=2 then
goto save_midi
end if
end if
print "SET M1 TO MIDI GLOBAL CHANNEL 16 (press key to continue)"
for index=0 to 7
out 3,peekb(varptr(combination_mode(0))+index)
while delay!>timer:wend
for index=0 to 147
out 3,peekb(varptr(sysex(0))+index)
DATA &hF042,&h3F19,&h4E00,&h10F7
DATA 48,50,51,55,55,56,60
DATA 48,50,52,55,55,57,60
DATA 48,50,51,53,55,56,59
DATA 48,50,52,53,55,57,59
DATA 00,01,02,03,04,05,06,07,08,09,10,11,12,13,14,15
DATA 16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31
DATA 32,31,30,29,28,27,26,25,24,23,22,21,20,19,18,17
DATA 16,15,14,13,12,11,10,09,08,07,06,05,04,03,02,01
DATA &h7F08,&h007F,&h017F,&h07F7