We've updated our Terms of Use. You can review the changes here.

Nebulullaby

by nebularosa

/
  • Streaming + Download

    Includes unlimited streaming via the free Bandcamp app, plus high-quality download in MP3, FLAC and more.

    Bonus track by xname.
    Purchasable with gift card

      £7 GBP  or more

     

  • Record/Vinyl + Digital Album

    A compilation that takes the lullaby genre into the realm of experimental electronic music, assembled from an open call for experimental lullabies launched in May 2014.

    The compilation includes tracks by well-known artists as well as first releases, with material on vinyl from d.R.e.G.S, 0xA, xname, Erich Barganier and Samuel Hertz and an expanded digital edition containing tracks from Thor Magnusson, Robert B. Lisek, Repl Electric, Claude Heiland-Allen, Marta Zapparoli and more hand-picked gems from the experimental techno, noise and electroacoustic scenes.

    The record guides the listener through eerily echoed music boxes to experiments in a syncopated 8-bit berceuse, with detours into clean planes of glassy textures, dives into opaque amniotic drones and concentrated, tender yet ominous moments, such as the sound of beating hearts against saturated, distant washes of feedback. Composed for Nintendo, Atari, Pure Data, Supercollider, D-Box, tape recorders, as well as ultraStethoscopes or using radioactive materials, these recordings treat the lullaby genre as an example of consciousness-altering music.

    PLEASE NOTE that the shipment is not tracked. if you want the shipment WITH tracking number please get in touch with us before placing the order. The seller won't be responsible for damage or loss of the shipped item.

    Includes unlimited streaming of Nebulullaby via the free Bandcamp app, plus high-quality download in MP3, FLAC and more.
    ... more
    ships out within 5 days
    edition of 500  5 remaining

      £13 GBP or more 

     

1.
2.
//***BLUE HERON: AMINO ACID LULLABY***\\ /* Follow the below steps to run Blue Heron. Amino Acid Cycles have variable intervals built into their patterns, so each cycle should be given time to run before starting the next one. Users will have to have the ProteinBioSynthesis external library installed to run pattern cycles: https://github.com/supercollider-quarks/ProteinBioSynthesis 1. Run SynthDef 2. Run Cycle 1 3. Run Cycle 2 4. " " 3 5. " " 4 6. Within the SynthDef, slowly change the impulse time number pairs within the .range(x, y) parameters. Suggested number pairs are listed next to it. Once you have changed the number pairs, run the code block again and the changes will take place. */ //SYNTHDEF init. ( SynthDef("amino", { arg out, freq=440, sustain=0.25, pan, p, amp=0.1; var u; u = Line.kr(1, 0, sustain, doneAction:2) * SinOsc.ar( freq, SinOsc.ar( freq * p, 0, BrownNoise.kr(pi/2) ) * Pulse.ar( LFNoise0.kr(1).range(2, 20) //impulse_time-- live coding: (2, 20) orig. (1, 5) --> (0.1, 1) --> (0.01, 0.1) --> (0.001, 0.01) ) ); Out.ar( out, Pan2.ar(u, pan, amp) ); }).store; ) //CYCLE 1 ( var pat; pat = AminoacidPattern("gatggatgcgatcggcttaggggctagcgatcgggatcg", inf); Pbind( \instrument, \amino, \degree, pat - 1,// 10 \stepsPerOctave, 5, \dur, pat *10, //10 \p, pat / 2, \legato, Prand([2, 1, 1, 7, 5, 1], inf) * 1.4, \pan, pat / 10 - 1, \amp, Pbrown(0.01, 0.05, 0.05, inf) ).play; ) //CYCLE 2 ( var pat; pat = AminoacidPattern("tatgatggggctagcgattcattccag", inf); Pbind( \instrument, \amino, \degree, pat - 1, // 10 \stepsPerOctave, 5, \dur, pat *20, //20 \p, pat / 1, \legato, Prand([9, 5, 10, 7, 15, 10], inf) * 1.4, \pan, pat / 10 - 1, \amp, Pbrown(0.01, 0.05, 0.09, inf) ).play; ) //CYCLE 3 ( var pat; pat = AminoacidPattern("atgatgattgctagctattcagtccag", inf); Pbind( \instrument, \amino, \degree, pat - 1, \stepsPerOctave, 12, \dur, pat *0.25, \p, pat / 1, \legato, Prand([9, 5, 10, 7, 15, 10], inf) * 1.4, \pan, pat / 10 - 1, \amp, Pbrown(0.01, 0.10, 0.05, inf) ).play; ) //CYCLE 4 ( var pat; pat = AminoacidPattern("catactgatctccatagccatcaggtc", inf); Pbind( \instrument, \amino, \degree, pat - 1, \stepsPerOctave, 12, \dur, pat *0.1, \p, pat / 1, \legato, Prand([1, 2, 1, 4, 1, 3], inf) * 1.4, \pan, pat / 10 - 1, \amp, Pbrown(0.01, 0.10, 0.05, inf) ).play; )
3.
https://gitlab.com/0xa/lullaby_in-c/blob/master/lullaby_in.c
4.
play{{({|i|x=i+1;SinOsc.ar(77*(x/2)+LFNoise2.ar(0.1).range(-2,2),0,LFNoise2.ar(0.5)*(Line.ar(0,0.1,99.rand)/(x*0.2)))}!rrand(9,28)).sum}!2}
5.
SynthDef( \growSynth, { | freq = 900 | var wave = LPF.ar(Pulse.ar(freq,0.10,0.30), 300); var noise = PinkNoise.ar(0.02); Out.ar(0, wave ! 2); Out.ar(0, noise ! 2); }).play; SynthDef( \lowSynth, { | freq = 1800 | var wave = LPF.ar(Pulse.ar(freq,0.10,0.30), 300); var noise = WhiteNoise.ar(0.0000000000000000001); Out.ar(0, wave ! 2); Out.ar(0, noise ! 2); }).play; SynthDef(\Ring, {arg freq = 440, dec = 1.0; var sin = SinOsc.ar(freq, 0, 0.25) * EnvGen.kr(Env.perc(0.01, dec), doneAction: 2); Out.ar(0, sin ! 2);}).play; ~drone = Pbind( \instrument, "\lowSynth", \scale, [0,2,5], \random, Pwhite(80, 100), \amp, Pseq([0.000000000000000000000000000000000000000000000000000000005], inf), \midinote, Pfunc({|event| event.at(\random).nearestInScale(event.at (\scale)); }), \dur, Pfunc({|event| var midinote, degree, scale; midinote = event.at(\midinote); scale = event.at(\scale); degree = midinote.keyToDegree(scale, 12) % scale.size + 1; if (degree%2==0, {0.2}, {1} ) }) ).play; ~ring = Pbind( \instrument, "\Ring", \scale, [0,2,4,5], \random, Pwhite(80, 100), \amp, Pseq([0.00000000000000000000000000005], inf), \midinote, Pfunc({|event| event.at(\random).nearestInScale(event.at (\scale)); }), \dur, Pfunc({|event| var midinote, degree, scale; midinote = event.at(\midinote); scale = event.at(\scale); degree = midinote.keyToDegree(scale, 12) % Page 1 Untitled scale.size + 1; if (degree%2==0, {0.2}, {1} ) }) ).play; ( Task({ ~ring.play; 20.wait; ~drone.play; 45.wait; }).play; ) s.makeGui; Page 2
6.
(def the-stars (dark-ambience)) (def nebula (growl [:head bass-g] :amp 0.0 :beat-trg-bus (:beat time/beat-16th) :beat-bus (:count time/beat-16th) :note-buf nebula-note-buf)) (def hydrogen (shrill-pong [:head voice-g] :amp 1.2 :note-buf hydrogen-note-buf :duration-bus hydrogen-dur-buf)) (def helium (shrill-pong [:head voice-g] :amp 1.2 :note-buf helium-note-buf :duration-bus helium-dur-buf)) (def supernova (shrill-pong [:head voice-g] :amp 0.1 :note-buf supernova-note-buf :duration-bus supernova-dur-buf)) (def stellar-wind (pulsar :note-buf stella-wind-note-buf :amp 0.7)) (def metallicity (fizzy-pulsar [:head backing-voice-g] :amp 0.6 :note-buf metallicity-note-buf :duration-bus supernova-dur-buf))
7.
8.
9.
10.
'Yo GABA GABA 'by David Jason Snow 'Sept. 16, 2014 'Language: HiSoft BASIC for the Atari Falcon030 computer defint a-z library "gemaes","gemdos" randomize(timer) CONST steps_per_quarternote=96 WINDOW OPEN 2,"",PEEKW(SYSTAB+58),PEEKW(SYSTAB+60),PEEKW(SYSTAB+62),PEEKW(SYSTAB+6 4),0 gosub initialize do scale=int(rnd*4) iterations=(int(rnd*13)+4)*8 if int(rnd*100)>49 then tempo=int(rnd*72)+112 gosub set_tempo else transposition=int(rnd*12)-6 end if for index=0 to 7 A!(index)=1+(rnd*1)/10 base_velocity(index)=(int(rnd*3)+1)*24 span(index)=(int(rnd*5)+1)*7+1 register(index)=int(rnd*(36-span(index))) if int(rnd*100)>64 then active_voice(index)=1 else active_voice(index)=0 end if next for pulse=1 to iterations for index=0 to 7 note(index)=pitch(scale,(X!(index)+1.5)*(span(index)/3)+register(index)) +transposition velocity(index)=(Y!(index)+.4)*(24/.8)+base_velocity(index) +velocity_scale(velocity_index(index)) velocity_index(index)=(velocity_index(index)+1) mod 64 new_X!(index)=Y!(index)+1.0-(A!(index)*(X!(index)*X!(index))) new_Y!(index)=B!*X!(index) X!(index)=new_X!(index) Y!(index)=new_Y!(index) next gosub play_note if FNabort then exit loop end if next loop mouse 0 gosub save_midi file system DEF FNabort if inp(-2)<>-1 then FNabort=0 else if inp(2)=27 then FNabort=1 else FNabort=0 end if end if END DEF SUB note_off(channel,pitch) SHARED smf_buffer&,smf_index& out 3,128+channel out 3,pitch out 3,64 gosub delta_conversion pokeb smf_buffer&+smf_index&,128+channel incr smf_index& pokeb smf_buffer&+smf_index&,pitch incr smf_index& pokeb smf_buffer&+smf_index&,64 incr smf_index& END SUB SUB note_on(channel,pitch,velocity) SHARED smf_buffer&,smf_index& out 3,144+channel out 3,pitch out 3,velocity gosub delta_conversion pokeb smf_buffer&+smf_index&,144+channel incr smf_index& pokeb smf_buffer&+smf_index&,pitch incr smf_index& pokeb smf_buffer&+smf_index&,velocity incr smf_index& END SUB play_note: for index=0 to 7 if active_voice(index) then note_on channel(index),note(index),velocity(index) end if next delta_time&=steps_per_unit delay!=timer+unit_duration! while delay!>timer: wend for index=0 to 7 if active_voice(index) then note_off channel(index),note(index) end if next return initialize: mouse -1 window fullw cls restore mode_data dim combination_mode(3) for index&=0 to 3 read word$ pokew varptr(combination_mode(0))+index&*2,val(word$) next restore sysex_data dim sysex(73) for index=0 to 73 read word$ pokew varptr(sysex(0))+index*2,val(word$) next dim channel(7) dim X!(7) dim Y!(7) dim new_X!(7) dim new_Y!(7) for index=0 to 7 channel(index)=index X!(index)=0 Y!(index)=0 new_X!(index)=0 new_Y!(index)=0 next B!=0.3 dim pitch(3,36) restore scale_1_data for index=0 to 6 read pitch(0,index) pitch(0,index+7)=pitch(0,index)+12 pitch(0,index+14)=pitch(0,index)+24 pitch(0,index+21)=pitch(0,index)+36 pitch(0,index+28)=pitch(0,index)+48 next pitch(0,35)=96 restore scale_2_data for index=0 to 6 read pitch(1,index) pitch(1,index+7)=pitch(1,index)+12 pitch(1,index+14)=pitch(1,index)+24 pitch(1,index+21)=pitch(1,index)+36 pitch(1,index+28)=pitch(1,index)+48 next pitch(1,35)=96 restore scale_3_data for index=0 to 6 read pitch(2,index) pitch(2,index+7)=pitch(2,index)+12 pitch(2,index+14)=pitch(2,index)+24 pitch(2,index+21)=pitch(2,index)+36 pitch(2,index+28)=pitch(2,index)+48 next pitch(2,35)=96 restore scale_4_data for index=0 to 6 read pitch(3,index) pitch(3,index+7)=pitch(3,index)+12 pitch(3,index+14)=pitch(3,index)+24 pitch(3,index+21)=pitch(3,index)+36 pitch(3,index+28)=pitch(3,index)+48 next pitch(3,35)=96 dim velocity_index(7) for index=0 to 7 velocity_index(index)=int(rnd*64) next restore velocity_data dim velocity_scale(63) for index=0 to 63 read velocity_scale(index) next gosub sysex_dump drive_no=FNdgetdrv getdir$=space$(128) getdir&=sadd(getdir$) dgetpath getdir&,0 index=0: while peekb(getdir&+index)<>32: index=index+1: wend path$=chr$(drive_no+65)+":"+left$(getdir$,index-1) midi file_path$=path$+"\*.MID" buffer_size&=fre(0)-&h20000 dim smf_buffer(buffer_size&\2) smf_buffer&=varptr(smf_buffer(0)) 'SET UP SMF HEADER CHUNK pokeb smf_buffer&,asc("M") pokeb smf_buffer&+1,asc("T") pokeb smf_buffer&+2,asc("h") pokeb smf_buffer&+3,asc("d") pokel smf_buffer&+4,6 'length of header pokew smf_buffer&+8,0 'SMF format 0 pokew smf_buffer&+10,1 '1 track pokew smf_buffer&+12,steps_per_quarternote 'SET UP TRACK CHUNK pokeb smf_buffer&+14,asc("M") pokeb smf_buffer&+15,asc("T") pokeb smf_buffer&+16,asc("r") pokeb smf_buffer&+17,asc("k") pokel smf_buffer&+18,0 'dummy track length smf_index&=22 tempo=int(rnd*72)+112 beat_division=4 gosub set_tempo transposition=int(rnd*12)-6 print "PRESS <ESC> TO ABORT." return set_tempo: steps_per_unit=STEPS_PER_QUARTERNOTE/beat_division step_duration!=60/(tempo*steps_per_quarternote) unit_duration!=steps_per_unit*step_duration! smf_tempo&=(60/tempo)*1000000 smf_tempo_ptr&=varptr(smf_tempo&) smf_buffer&=varptr(smf_buffer(0)) pokeb smf_buffer&+smf_index&,&h00 'delta time incr smf_index& pokeb smf_buffer&+smf_index&,&hff 'meta event incr smf_index& pokeb smf_buffer&+smf_index&,&h51 incr smf_index& pokeb smf_buffer&+smf_index&,&h03 incr smf_index& pokeb smf_buffer&+smf_index&,peekb(smf_tempo_ptr&+1) incr smf_index& pokeb smf_buffer&+smf_index&,peekb(smf_tempo_ptr&+2) incr smf_index& pokeb smf_buffer&+smf_index&,peekb(smf_tempo_ptr&+3) incr smf_index& return 'DELTA TIME VARIABLE-LENGTH QUANTITY CONVERSION delta_conversion: vlq_buffer&=0 vlq_pointer&=varptr(vlq_buffer&) pokeb vlq_pointer&+3,delta_time& and &h7f pointer_offset&=2 delta_time&=delta_time&\&h80 while delta_time&<>0 pokeb vlq_pointer&+pointer_offset&,delta_time& or &h80 decr pointer_offset& delta_time&=delta_time&\&h80 wend incr pointer_offset& while pointer_offset&<4 pokeb smf_buffer&+smf_index&,peekb(vlq_pointer&+pointer_offset&) incr smf_index& incr pointer_offset& wend return save_midi file: beep mouse 0 'APPEND END-OF-TRACK META-EVENT delta_time&=0 gosub delta_conversion pokeb smf_buffer&+smf_index&,&hff 'meta-event incr smf_index& pokeb smf_buffer&+smf_index&,&h2f incr smf_index& pokeb smf_buffer&+smf_index&,&h00 pokel smf_buffer&+18,smf_index&-22 'update sequence length save_midi: file_name$="" fsel_input midi file_path$, file_name$,ok if ok then if file_name$="" then alert$="[3][Are you sure you want|to discard MIDI file?][Yes|No]" if FNform_alert(1,alert$)=2 then goto save_midi end if else mouse 2 index=len(midi file_path$) while index>0 and mid$(midi file_path$,index,1)<>"\" decr index wend exit_file$=left$(midi file_path$,index)+file_name$ BSAVE exit_file$,SMF_BUFFER&,SMF_INDEX& mouse 0 end if else alert$="[3][Are you sure you want|to discard MIDI file?][Yes|No]" if FNform_alert(1,alert$)=2 then goto save_midi end if end if RETURN sysex_dump: print "SET M1 TO MIDI GLOBAL CHANNEL 16 (press key to continue)" keypress=inp(2) for index=0 to 7 out 3,peekb(varptr(combination_mode(0))+index) next delay!=timer+.5 while delay!>timer:wend for index=0 to 147 out 3,peekb(varptr(sysex(0))+index) next cls return mode_data: DATA &hF042,&h3F19,&h4E00,&h10F7 scale_1_data: DATA 48,50,51,55,55,56,60 scale_2_data: DATA 48,50,52,55,55,57,60 scale_3_data: DATA 48,50,51,53,55,56,59 scale_4_data: DATA 48,50,52,53,55,57,59 velocity_data: DATA 00,01,02,03,04,05,06,07,08,09,10,11,12,13,14,15 DATA 16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31 DATA 32,31,30,29,28,27,26,25,24,23,22,21,20,19,18,17 DATA 16,15,14,13,12,11,10,09,08,07,06,05,04,03,02,01 sysex_data: DATA &hF042,&h3F19,&h4900,&h4368,&h616F,&h7320,&h2000,&h2020,&h2004,&h1601 DATA &h6400,&h6412,&h1200,&h003F,&h0000,&h0200,&h0000,&h0006,&h0440,&h1500 DATA &h1C1E,&h4A00,&h7A01,&h7D69,&h4800,&h0005,&h7F08,&h007F,&h017F,&h0075 DATA &h4800,&h0000,&h057F,&h007F,&h0101,&h7F01,&h7F48,&h0000,&h0550,&h7F00 DATA &h7F01,&h7F02,&h0700,&h4800,&h0005,&h7F00,&h7F0A,&h017F,&h0325,&h4800 DATA &h0020,&h057F,&h007F,&h017F,&h0401,&h3148,&h0000,&h057F,&h0004,&h7F01 DATA &h7F05,&h6548,&h0040,&h0005,&h7F00,&h7F01,&h7F02,&h0617,&h4800,&h0005 DATA &h7F08,&h007F,&h017F,&h07F7
11.
12.

credits

released May 1, 2016

license

Some rights reserved. Please refer to individual track pages for license info.

tags

about

nebularosa London, UK

consciousness altering music

contact / help

Contact nebularosa

Streaming and
Download help

Redeem code

Report this album or account

If you like nebularosa, you may also like: